ABSTRACT
Substance-use disorders (SUDs) and drug addiction are not only national, but also global health concerns that have worsened during and after the COVID-19 pandemic. Acupuncture augments the endogenous opioid system and, therefore, has a theoretical basis as a treatment for opioid use disorders (OUDs). The basic science of acupuncture, its clinical research in addiction medicine, and decades of success of the National Acupuncture Detoxification Association protocol offer positive findings supporting this protocol's utility for treating SUDs. Considering the mounting opioid/substance-use concerns and deficiencies in SUD treatment availability in the United States, acupuncture can be a safe, feasible treatment option and adjunct in addiction medicine. Furthermore, large governmental agencies are lending support to acupuncture for treating acute and chronic pain, which, in turn, could translate to prevention of SUDs and addictions. This article is a narrative review of the background, the basic science and clinical research, and future direction of acupuncture in addiction medicine.
ABSTRACT
PURPOSE: The aim of this study was to analyze the impact of using intra-procedural pre-ablation contrast-enhanced CT prior to percutaneous thermal ablation (pre-ablation CECT) of colorectal liver metastases (CLM) on local outcomes. MATERIALS AND METHODS: This retrospective analysis of a prospectively collected liver ablation registry included 144 consecutive patients (median age 57 years IQR [49, 65], 60% men) who underwent 173 CT-guided ablation sessions for 250 CLM between October 2015 and March 2020. In addition to oncologic outcomes, technical success was retrospectively evaluated using a biomechanical deformable image registration software for 3D-minimal ablative margin (3D-MAM) quantification. Bayesian regression was used to estimate effects of pre-ablation CECT on residual unablated tumor, 3D-MAM, and local tumor progression-free survival (LTPFS). RESULTS: Pre-ablation CECT was acquired in 71/173 (41%) sessions. Residual unablated tumor was present in one (0.9%) versus nine tumors (6.6%) ablated with versus without using pre-ablation CECT, respectively (p = 0.024). Pre-ablation CECT use decreased the odds of residual disease on first follow-up by 78% (CI95% [5, 86]) and incomplete ablation (3D-MAM ≤ 0 mm) by 58% (CI95% [13, 122]). The odds ratio for residual unablated tumor for larger CLM was lower when pre-ablation CECT was used (odds ratio 1.0 with pre-ablation CECT vs. 2.52 without). Pre-ablation CECT use was not associated with improvements on LTPFS. CONCLUSIONS: Pre-ablation CECT is associated with improved immediate outcomes by significantly reducing the incidence of residual unablated tumor and by mitigating the risk of incomplete ablation for larger CLM. We recommend performing baseline intra-procedural pre-ablation CECT as a standard imaging protocol. LEVEL OF EVIDENCE: Level 3 (retrospective cohort study).
Subject(s)
Catheter Ablation , Colorectal Neoplasms , Liver Neoplasms , Male , Humans , Middle Aged , Female , Retrospective Studies , Contrast Media , Bayes Theorem , Liver Neoplasms/diagnostic imaging , Liver Neoplasms/surgery , Liver Neoplasms/pathology , Tomography, X-Ray Computed/methods , Colorectal Neoplasms/pathology , Catheter Ablation/methods , Treatment OutcomeABSTRACT
In the fourth year of the COVID-19 pandemic, public health authorities worldwide have adopted a strategy of learning to live with SARS-CoV-2. This has involved the removal of measures for limiting viral spread, resulting in a large burden of recurrent SARS-CoV-2 infections. Crucial for managing this burden is the concept of the so-called wall of hybrid immunity, through repeated reinfections and vaccine boosters, to reduce the risk of severe disease and death. Protection against both infection and severe disease is provided by the induction of neutralizing antibodies (nAbs) against SARS-CoV-2. However, pharmacokinetic (PK) waning and rapid viral evolution both degrade nAb binding titers. The recent emergence of variants with strongly immune evasive potential against both the vaccinal and natural immune responses raises the question of whether the wall of population-level immunity can be maintained in the face of large jumps in nAb binding potency. Here we use an agent-based simulation to address this question. Our findings suggest large jumps in viral evolution may cause failure of population immunity resulting in sudden increases in mortality. As a rise in mortality will only become apparent in the weeks following a wave of disease, reactive public health strategies will not be able to provide meaningful risk mitigation. Learning to live with the virus could thus lead to large death tolls with very little warning. Our work points to the importance of proactive management strategies for the ongoing pandemic, and to the need for multifactorial approaches to COVID-19 disease control.
Subject(s)
COVID-19 , Severe Acute Respiratory Syndrome , Death , Hearing Loss, SuddenABSTRACT
Boosting protein production is invaluable in both industrial and academic applications. We discovered a novel expression-increasing 21-mer cis-regulatory motif (Exin21) that inserts between SARS-CoV-2 envelope (E) protein-encoding sequence and luciferase reporter gene. This unique Exin21 (CAACCGCGGTTCGCGGCCGCT), encoding a heptapeptide (QPRFAAA, designated as Qα), significantly (34-fold on average) boosted E production. Both synonymous and nonsynonymous mutations within Exin21 diminished its boosting capability, indicating the exclusive composition and order of 21 nucleotides. Further investigations demonstrated that Exin21/Qα addition could boost the production of multiple SARS-CoV-2 structural proteins (S, M, and N) and accessory proteins (NSP2, NSP16, and ORF3), and host cellular gene products such as IL-2, IFN-γ, ACE2, and NIBP. Exin21/Qα enhanced the packaging yield of S-containing pseudoviruses and standard lentivirus. Exin21/Qα addition on the heavy and light chains of human anti-SARS-CoV monoclonal antibody robustly increased antibody production. The extent of such boosting varied with protein types, cellular density/function, transfection efficiency, reporter dosage, secretion signaling, and 2A-mediated auto-cleaving efficiency. Mechanistically, Exin21/Qα increased mRNA synthesis/stability, and facilitated protein expression and secretion. These findings indicate that Exin21/Qα has the potential to be used as a universal booster for protein production, which is of importance for biomedicine research and development of bioproducts, drugs, and vaccines.
Subject(s)
COVID-19 , Viral Vaccines , Humans , SARS-CoV-2/genetics , Signal Transduction , RNA, Messenger/geneticsABSTRACT
The impact of coronavirus disease 2019 (COVID-19) pandemic on patients with neurodegenerative diseases and the specific neurological manifestations of COVID-19 have aroused great interest. However, there are still many issues of concern to be clarified. Therefore, we review the current literature on the complex relationship between COVID-19 and neurodegenerative diseases with an emphasis on Parkinson's disease (PD) and Alzheimer's disease (AD). We summarize the impact of COVID-19 infection on symptom severity, disease progression, and mortality rate of PD and AD, and discuss whether COVID-19 infection could trigger PD and AD. In addition, the susceptibility to and the prognosis of COVID-19 in PD patients and AD patients are also included. In order to achieve better management of PD and AD patients, modifications of care strategies, specific drug therapies, and vaccines during the pandemic are also listed. At last, mechanisms underlying the link of COVID-19 with PD and AD are reviewed.
Subject(s)
Alzheimer Disease , COVID-19 , Neurodegenerative Diseases , Parkinson Disease , Humans , Alzheimer Disease/diagnosis , Alzheimer Disease/epidemiology , Alzheimer Disease/therapy , Parkinson Disease/diagnosis , Parkinson Disease/epidemiology , Parkinson Disease/therapy , Disease ProgressionABSTRACT
The current coronavirus disease 2019 (COVID-19) pandemic has reinforced the necessity of understanding and establishing baseline information on the fate and transport mechanisms of viruses under indoor environmental conditions. Mechanisms governing virus interactions in built spaces have thus far been established based on our knowledge on the interaction of inorganic particles in indoor spaces and do not include characteristics specific to viruses. Studies have explored the biological and kinetic processes of microbes' attachments on surfaces in other fields but not in the built environment. There is also extensive literature on the influence of indoor architecture on air flow, temperature profiles, and forces influencing aerosol transport. Bridging the gap between these fields will lead to the generation of novel frameworks, methodologies and know-how that can identify undiscovered pathways taken by viruses and other microbes in the built environment. Our study summarizes the assessment of the influence of surface properties on the adhesion kinetics of vaccinia virus on gold, silica, glass, and stainless-steel surfaces. We found that on gold the virus layer was more viscoelastic compared to stainless-steel. There was negligible removal of the layer from the stainless-steel surface compared to the others. The results further highlight the importance of converging different fields of research to assess the fate and transport of microbes in indoor built spaces.
ABSTRACT
While the rapid deployment of SARS-CoV-2 vaccines had a significant impact on the ongoing COVID-19 pandemic, rapid viral immune evasion and waning neutralizing antibody titers have degraded vaccine efficacy. Nevertheless, vaccine manufacturers and public health authorities have a number of levers at their disposal to maximize the benefits of vaccination. Here, we use an agent-based modeling framework coupled with the outputs of a population pharmacokinetic model to examine the impact of boosting frequency and durability of vaccinal response on vaccine efficacy. Our work suggests that repeated dosing at frequent intervals (multiple times a year) may offset the degradation of vaccine efficacy, preserving their utility in managing the ongoing pandemic. Our work relies on assumptions about antibody accumulation and the tolerability of repeated vaccine doses. Given the practical significance of potential improvements in vaccinal utility, clinical research to better understand the effects of repeated vaccination would be highly impactful. These findings are particularly relevant as public health authorities worldwide seek to reduce the frequency of boosters to once a year or less. Our work suggests practical recommendations for vaccine manufacturers and public health authorities and draws attention to the possibility that better outcomes for SARS-CoV-2 public health remain within reach.
Subject(s)
COVID-19ABSTRACT
As the COVID-19 pandemic continues unabated, many governments and public-health bodies worldwide have ceased to implement concerted measures for limiting viral spread, placing the onus instead on the individual. In this paper, we examine the feasibility of this proposition using an agent-based model to simulate the impact of individual shielding behaviors on reinfection frequency. We derive estimates of heterogeneity in immune protection from a population pharmacokinetic (pop PK) model of antibody kinetics following infection and variation in contact rate based on published estimates. Our results suggest that individuals seeking to opt out of adverse outcomes upon SARS-CoV-2 infection will find it challenging to do so, as large reductions in contact rate are required to reduce the risk of infection. Our findings suggest the importance of a multilayered strategy for those seeking to reduce the risk of infection. This work also suggests the importance of public health interventions such as universal masking in essential venues and air quality standards to ensure individual freedom of choice regarding COVID-19.
Subject(s)
COVID-19ABSTRACT
The ongoing COVID-19 pandemic has placed an unprecedented burden on global health. Crucial for managing this burden, the existing SARS-CoV-2 vaccines have substantially reduced the risk of severe disease and death up to this point. The induction of neutralizing antibodies (nAbs) by these vaccines leads to protection against both infection and severe disease. However, pharmacokinetic (PK) waning and rapid viral evolution degrade neutralizing antibody binding titers, leading to a rapid loss of vaccinal protection against infection occurring on the order of months after vaccination. Additionally, inter-individual heterogeneity in the strength and durability of the vaccine-induced neutralizing response to SARS-CoV-2 can create a further public-health risk by placing a subset of the population at risk. Here we incorporate the heterogeneity in inter-individual response into a pharmacokinetic/ pharmacodynamic (PK/PD) model to project the degree of heterogeneity in immune protection. We extend our model-based approach to examine the impact of evolutionary immune evasion on vaccinal protection. Our findings suggest that viral evolution can be expected to impact the effectiveness of vaccinal protection against severe disease, particularly for individuals with a shorter duration of immune response. One possible solution to immune heterogeneity may be more frequent boosting for individuals with a weaker immune response. We demonstrate a model-based approach to targeted boosting that involves the use of the ECLIA RBD assay to identify individuals whose immune response is insufficient for protection against severe disease. Our work suggests that vaccinal protection against severe disease is not assured and provides a path forward to reducing the risk to immunologically vulnerable individuals.
Subject(s)
COVID-19 , Parkinson Disease , DeathABSTRACT
Promoting the sustainable development of rural EFL students’ English ability is a vital issue in the general curriculum guidelines of Taiwan’s 12-Year Basic Education. This study aimed to investigate the effects of a Facebook project on developing rural EFL learners’ email literacy in English. There were two participant groups: (1) six university English majors and (2) 12 ninth-graders from a rural junior high school. The instruments included a multiple-choice awareness task (MCT), a written discourse completion task (WDCT), a perception questionnaire, interviews, and teaching journals. The university students first received a training session on email literacy, and then they taught the ninth-graders invitation email-writing through Facebook interactions for eight weeks. The results showed that after the project, the ninth-graders made significant improvements when completing the MCT. As for the quality of their emails, the ninth-graders not only scored significantly higher in the post-test but also made qualitative progress in their invitation emails. Furthermore, both participant groups had positive perceptions of this project and indicated the strengths and weaknesses of their participation. This paper concludes with pedagogical implications for English education in Taiwan.
ABSTRACT
Homologous and heterologous booster with COVID-19 mRNA vaccines represent the most effective strategy to prevent the ongoing Omicron pandemic. The additional protection from these prototype SARS-CoV-2 S-targeting vaccine was attributed to the increased RBD-specific memory B cells with expanded potency and breadth. Herein, we show the safety and immunogenicity of heterologous boosting with the RBD-targeting mRNA vaccine AWcorna (also term ARCoV) in Chinese adults who have received two doses inactivated vaccine. The superiority over inactivated vaccine in neutralization antibodies, as well as the safety profile, support the use of AWcorna as heterologous booster in China.
Subject(s)
COVID-19ABSTRACT
Objective: To understand and analyze the epidemic status and development trends of soil-transmitted nematodiasis in Guangxi Zhuang Autonomous Region (Guangxi), to provide scientific basis for formulating the disease control strategy, and evaluating the control effect.
ABSTRACT
The coronavirus disease 2019 (COVID-19) has outbreak since early December 2019, and COVID-19 has caused over 100 million cases and 2 million deaths around the world. After one year of the COVID-19 outbreak, there is no certain and approve medicine against it. Drug repositioning has become one line of scientific research that is being pursued to develop an effective drug. However, due to the lack of COVID-19 data, there is still no specific drug repositioning targeting the COVID-19. In this paper, we propose a framework for COVID-19 drug repositioning. This framework has several advantages that can be exploited: one is that a local graph aggregating representation is used across a heterogeneous network to address the data sparsity problem; another is the multi-hop neighbors of the heterogeneous graph are aggregated to recall as many COVID-19 potential drugs as possible. Our experimental results show that our COVDR framework performs significantly better than baseline methods, and the docking simulation verifies that our three potential drugs have the ability to against COVID-19 disease.
Subject(s)
COVID-19 , Pharmaceutical Preparations , Antiviral Agents , Drug Repositioning , Humans , Molecular Docking Simulation , SARS-CoV-2ABSTRACT
The continuance of the COVID-19 pandemic largely depends on the spread of virus-carrying aerosols in ambient air. The mechanism of virus transmission and infection remains under intense investigation. In this study, an evaporation flow model of airborne sputum droplets is proposed which considers the evolution effects of the humidity field under different particle distributions and solid/salt fraction interactions. The incompressible Navier–Stokes equations characterize a stream of airflow jets, and the convection-diffusion-evaporation process is used to account for the inhomogeneous humidity field caused by the respiratory tract. Momentum equations for droplet dynamics which involve the effects of drag, gravity, and Brownian motion on sputum droplets are introduced to quantify the transport of droplets in a humidity field. The Lattice Boltzmann method is used to track the evolution of the aerosol in space and time under different ambient temperature and relative humidity conditions. The results of the simulation demonstrate that airborne humidity accelerates the evaporation rate of droplet, while supersaturated humid air forms a vapor mass in front of the respiratory tract. Despite the short lifespan of this phenomenon, it significantly hinders the evaporation of the droplets. Besides, the droplet vortex dynamics in a humidity field are sensitive to the droplet size.
ABSTRACT
Non-contact physiological measurements based on image sensors have developed rapidly in recent years. Among them, thermal cameras have the advantage of measuring temperature in the environment without light and have potential to develop physiological measurement applications. Various studies have used thermal camera to measure the physiological signals such as respiratory rate, heart rate, and body temperature. In this paper, we provided a general overview of the existing studies by examining the physiological signals of measurement, the used platforms, the thermal camera models and specifications, the use of camera fusion, the image and signal processing step (including the algorithms and tools used), and the performance evaluation. The advantages and challenges of thermal camera-based physiological measurement were also discussed. Several suggestions and prospects such as healthcare applications, machine learning, multi-parameter, and image fusion, have been proposed to improve the physiological measurement of thermal camera in the future.
Subject(s)
Respiratory Rate , Signal Processing, Computer-Assisted , Algorithms , Heart Rate , Machine LearningABSTRACT
BACKGROUND: Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) is highly transmissible and has caused a pandemic named coronavirus disease 2019 (COVID-19), which has quickly spread worldwide. Although several therapeutic agents have been evaluated or approved for the treatment of COVID-19 patients, efficacious antiviral agents are still lacking. An attractive therapeutic target for SARS-CoV-2 is the main protease (Mpro), as this highly conserved enzyme plays a key role in viral polyprotein processing and genomic RNA replication. Therefore, the identification of efficacious antiviral agents against SARS-CoV-2 Mpro using a rapid, miniaturized and economical high-throughput screening (HTS) assay is of the highest importance at the present. RESULTS: In this study, we first combined the fluorescence polarization (FP) technique with biotin-avidin system (BAS) to develop a novel and step-by-step sandwich-like FP screening assay to quickly identify SARS-CoV-2 Mpro inhibitors from a natural product library. Using this screening assay, dieckol, a natural phlorotannin component extracted from a Chinese traditional medicine Ecklonia cava, was identified as a novel competitive inhibitor against SARS-CoV-2 Mpro in vitro with an IC50 value of 4.5 ± 0.4 µM. Additionally, dieckol exhibited a high affinity with SARS-CoV-2 Mpro using surface plasmon resonance (SPR) analysis and could bind to the catalytic sites of Mpro through hydrogen-bond interactions in the predicted docking model. CONCLUSIONS: This innovative sandwich-like FP screening assay enables the rapid discovery of antiviral agents targeting viral proteases, and dieckol will be an excellent lead compound for generating more potent and selective antiviral agents targeting SARS-CoV-2 Mpro.
ABSTRACT
Human cerebral organoid (CO) is a three-dimensional (3D) cell culture system that recapitulates the developing human brain. While CO has proved an invaluable tool for studying neurological disorders in a more clinically relevant matter, there have still been several shortcomings including CO variability and reproducibility as well as lack of or underrepresentation of certain cell types typically found in the brain. As the technology to generate COs has continued to improve, more efficient and streamlined protocols have addressed some of these issues. Here we present a novel scalable and simplified system to generate microglia-containing CO (MCO). We characterize the cell types and dynamic development of MCOs and validate that these MCOs harbor microglia, astrocytes, neurons, and neural stem/progenitor cells, maturing in a manner that reflects human brain development. We introduce a novel technique for the generation of embryoid bodies (EBs) directly from induced pluripotent stem cells (iPSCs) that involves simplified steps of transitioning directly from 3D cultures as well as orbital shaking culture in a standard 6-well culture plate. This allows for the generation of MCOs with an easy-to-use system that is affordable and accessible by any general lab.
ABSTRACT
Transmission-blocking vaccines are urgently needed to reduce transmission of SARS-CoV 2, the cause of the COVID-19 pandemic. The upper respiratory tract is an initial site of SARS-CoV-2 infection and, for many individuals, remains the primary site of virus replication. An ideal COVID-19 vaccine should reduce upper respiratory tract virus replication and block transmission as well as protect against severe disease. Here, we optimized a vaccine candidate, parainfluenza virus 5 (PIV5) expressing the SARS-CoV-2 S protein (CVXGA1), and then demonstrated that a single-dose intranasal immunization with CVXGA1 protects against lethal infection of K18-hACE2 mice, a severe disease model. CVXGA1 immunization also prevented virus infection of ferrets and blocked contact transmission. This mucosal vaccine strategy inhibited SARS-CoV-2 replication in the upper respiratory tract, thus preventing disease progression to the lower respiratory tract. A PIV5-based mucosal vaccine provides a strategy to induce protective innate and cellular immune responses and reduce SARS-CoV-2 infection and transmission in populations.